NONYLPHENOL INDUCES EXPRESSION OF THE T-BOX6 GENE IN ZEBRAFISH EMBRYOS: RNA Extraction

RNA Extraction

RNA was extracted using a modification of the method of Chomczynski P, Sacchi (1987)32. In brief, 30 frozen embryos were carefully homogenized in 1 ml of GuaSCN-buffer (3 M guanidinthiocyante, 50 mM TRIS, 10 mM EDTA, 8% sarcosyl, 1% P-mercapethanol pH 7.0). After addition of 0.1 ml of 2 M sodium acetate (pH 4), 1 ml water saturated phenol and 0.2 ml chloroform the samples were centrifuged at 15.000g for 15 min. The supernatant was collected and RNA was precipitated by adding of 1 ml of isopropanol followed by two ethanol (70%) washes. Concentration and purity of RNA was determined by absorption measurement at 230, 260 and 280 nm.

cDNA Synthesis

Two hundred ng total RNA was digested with DNase for 30 min at 37°C, terminated by adding EDTA to final a concentration of 25^mol/l) and then transcribed. Reverse transcription was carried out in a total volume of 20 ц1 containing 10 mmol/l Tris-HCl, (pH 8.8), 50 mmol/l KCl, 5 mmol/L MgCl2, 1 mmol/l each dNTPs, 0.5 ^g oligo (dT) primers, 0.5 ^g random primers, 25 U RNase inhibitor, and 200 U M-MuLV reverse transcriptase for 5 min at 25°C followed 1 hr at 42°min. The reaction was stopped by incubation for 5 min at 70°C.

Real time PCR

Real time PCR was performed in an Applied Biosystems 7500 Real-Time PCR System using 1 ц1 of the synthesized cDNA in a final volume of 15 ц1. Details on the primer combinations are shown in Table 3. Each assay included a no template control and all measurements were performed in duplicate. The efficiency of the system was measured by using serial 2-fold dilutions of a mixture of different cDNAs. The efficiency indicates the amplicon doubling rate of a primer pair. The Ct value is defined as the number of cycles needed for the fluorescence signal to rise above a threshold level of detection. Obtained Ct values of the dilution series were plotted and the resulting slope of the linear graph was used for calculation of the system efficiency using the equation: E=1/101/slope (33). The system efficiency ranged between 1.91 and 2.11 (Table 2). The dissociation plots (melting curve analysis) indicated a single peak for all primer pairs further supporting specificity. To evaluate the different housekeeping genes used in the study the original concentration of the transcript was calculated using the formula Conc trans= E-Ct . The concentration of the transcripts ntl, spt and tbx6 related to the housekeeping genes efla and rp}13a was calculated using the formula:Nonylphenol Induces Expression_decrypted-1

Table 2 : Primers used for Real time PCR

Forward Primer 5’-3’ Reverse Primer 5’-3’ Amplicon size (bp) System efficiency (E Reference
fi-actin CGAGCT GT CTT CCCAT CC A TCACCAACGTAGCTGTCTTTCTG 86 2.00 42
3a TCTGGAGGACTGTAAGAGGTATGC AGACGCACAATCTTGAGAGCAG 148 1.91 42
efla AGACGCACAATCTTGAGAGCAG ATCAAGAAGAGTAG T ACCGCT AGCATT AC 87 1.95 42
ntl ACGAATGTTTCCCGTGCTCA CGTTCACGTATTTCCACCGAT 112 1.91 this paper
spt CTGGTGCCGTATGCAAAGTACA AGCTTT ACCT GC AACCTCCCA 103 2.00 this paper
tbx6 CACAGCT CT CGAT CTT GC AGTG T AT GGATTAGAT TGCCGGACT 93 1.93 this paper

The concentrations of the transcript (arbitrary units) were multiplied by a transcript-specific factor to gain a scale from 0 to 100. These concentrations are comparable within one transcript but not between transcripts.

Statistics

Statistical significances of relative mRNA expression between different NP isomers were determined using Prism®4.03 (GraphPad Software, La Jolla, CA USA). The calculated concentrations related to the expression of fpl13a and efla were log transformed and univariate analyses of variance (ANOVA) were performed to detect statistically significant differences between any groups. Data are expressed as mean ±standard error of the mean (SEM), arbitrary units, values related to the expression of the gene of interest in the DMSO control and related to the mean of the expression observed with rpl13a gene and efla gene. As post test to determine the actual differences between individual groups the Tukey-Kramer test was employed. The p-value of p

Representative APR 391%

Let's say you want to borrow $100 for two week. Lender can charge you $15 for borrowing $100 for two weeks. You will need to return $115 to the lender at the end of 2 weeks. The cost of the $100 loan is a $15 finance charge and an annual percentage rate of 391 percent. If you decide to roll over the loan for another two weeks, lender can charge you another $15. If you roll-over the loan three times, the finance charge would climb to $60 to borrow the $100.

Implications of Non-payment: Some lenders in our network may automatically roll over your existing loan for another two weeks if you don't pay back the loan on time. Fees for renewing the loan range from lender to lender. Most of the time these fees equal the fees you paid to get the initial payday loan. We ask lenders in our network to follow legal and ethical collection practices set by industry associations and government agencies. Non-payment of a payday loan might negatively effect your credit history.

Calculate APR